Y-DNA haplogroups are useful to determine whether two apparently unrelated individuals sharing the same surname do indeed descend from a common ancestor in a not too distant past (3 to 20 generations). In Europe west of the Black Sea, Haplogroup G is found at about 5% of the population on average throughout most of the continent. Elizabeth T Wood, Daryn A Stover, Christopher Ehret, L177, later discarded in favour of PF3359 and equivalent SNPs, was first identified at. Proc Natl Acad Sci USA 2011; 108: 97889791.
Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the The formula for the coalescence calculations is as follows: Age=25/1000 ASD0/0.00069. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK . These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. Dulik MC, Zhadanov SI, Osipova LP et al. Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). Haplogroup H While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. The G-P303 phylogenetic network was constructed using 248 G2a3b-P303-derived 19-locus haplotypes from populations representing Europe, Middle/Near East, South/Central Asia and the Caucasus and belonging to five sub-clades P303*, U1, M527, M426 and L497. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. PAU thanks Professor Carlos D Bustamante. Proc Natl Acad Sci USA 2011; 108: 1825518259. G1-M285, previously described in the Iranian population . So far all G2a1 persons have a value of 10 at STR marker DYS392. But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. It has an extremely low frequency in modern populations, except (i) Iran and its western neighbors, and (ii) a region straddling south Central Siberia (Russia) and northern Kazakhstan. First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). Here we present the haplogroup frequency distribution and STR variation of 16 informative G sub-clades by evaluating 1472 haplogroup G chromosomes belonging to 98 populations ranging from Europe to Pakistan. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. This is likely due to a local founder effect.[40]. An assessment of the Y-chromosome phylogeography-based proposal that the spread of G2a-L497 chromosomes originated from Central Europe could be achieved by typing this SNP in the Holocene period human remains from Germany31 as well as those from France and Spain.45, 46 Certainly, Y chromosome represents only a small part of human genome and any population-level interpretation of gene flow in this region would have to be supported by genome-wide evidence. A plot of the sub-clades included in the principal component analysis (Figure 3b) indicates that the clustering of the populations from NW Caucasus is due to their U1* frequency, whereas L497 lineages account for the separation of central Europeans.
G-L42/S146 (Y-DNA) - geni family tree The most probably region of the initial phase of G-M201 is estimated to be in Anatolia, Armenia or western Iran. Haplogroup G is observed in this survey as G1-M285 and G2a-P15. Summary. Genome Res 2008; 18: 830838. Ann Hum Genet 2008; 72: 205214. [42] The technical specifications of M201 are given as: refSNPid is rs2032636..Y chromosome location of 13536923.forward primer is tatgcatttgttgagtatatgtc..reverse primer is gttctgaatgaaagttcaaacg..the mutation involves a change from G to T. A number of SNPs have been identified with seemingly the same coverage in the population as M201. Its identification caused considerable renaming of G categories. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective.
Armenian DNA Project - News | FamilyTreeDNA suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. P287 was identified at the University of Arizona and became widely known in late 2007. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Amongst the Madjars, G1 was found at a rate of 87%. Rosser ZH, Zerjal T, Hurles ME et al. [43] L240 was identified in 2009. Zalloua PA, Xue Y, Khalife J et al. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. Goncalves R, Freitas A, Branco M et al. [6], A more eastern origin has also been mentioned, believed by some to originate in an area close to the Himalayan foothills. PLoS One 2011; 6: e17548. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. The L141 mutation is found on the Y chromosome at 2948607. Semino O, Magri C, Benuzzi G et al.
Haplogroup_G_(Y-DNA) Capelli C, Brisighelli F, Scarnicci F et al. Moreover, the accuracy and validity of the evolutionary rate has been independently confirmed in several deep-rooted Hutterite pedigrees.34 Furthermore pedigree rate-based estimates cannot be substantiated, as they are often inconsistent with dateable archeological knowledge, for example, as clearly illustrated regarding the peopling of the Americas.35 Coalescent times based on 10 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461-TAGA counts) and the median haplotypes of specific hg G sub-haplogroups are presented in Supplementary Table S4. In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations. [5] Cinnioglu et al. Its age is between 7,700 and . Haplogroup G (Y-DNA) In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. They are found only in tiny numbers elsewhere. The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. The new phylogenetic and phylogeographic information provides additional insights into the demographic history and migratory events in Eurasia involving hg G. The present study comprises data from 98 populations totaling 17577 individuals, of which 1472 were members of hg G. The haplogroup frequency data are presented in Supplementary Table S1. Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. A high percentage of G-Z1903 men belong to its subclade, G-Z724. Although progress has been recently made in resolving the haplogroup G phylogeny, a comprehensive survey of the geographic distribution patterns of the significant sub-clades of this haplogroup has not been conducted yet. The M527-defined sub-clade is unusual in that it reflects the presence of hg G-U1 that is otherwise rare in Europe. Vernesi C, Caramelli D, Dupanloup I et al. Age: About 7,800 years ago Origin: Eurasia Y-Haplotree. Artefactual values below 0% values were not depicted.
Neolithic mitochondrial haplogroup H genomes and the genetic - Nature The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). The SNP L177 (a.k.a. Semino et al. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. Y-STR haplotypes were used to construct phylogenetic networks for haplogroups G-P303, G-P16 and G-M377, using the program Network 4.6.0.0 (Fluxus-Engineering, Suffolk, England, UK) and applying the median-joining algorithm. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. The British samples have inconsistent double values for STR marker DYS19 in many cases. Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ : Y-chromosome diversity characterizes the Gulf of Oman. Lacan M, Keyser C, Ricaut FX et al. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. Am J Hum Genet 2004; 74: 10231034. . The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. In Lebanon, however, G accounts for 6.5% of the population and in Iran to around 10%. Cinnioglu C, King R, Kivisild T et al. Although both broadly distributed, G2a-P15* and its downstream L91 sub-lineage have low frequencies, with the exception of Sardinia and Corsica. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201. We attempted to localize the potential geographic origin of . G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa . Haplogroup G2a2b is a rare group today in Europe. The corresponding coalescent estimate for M377 is 5600 years ago (Supplementary Table S4). For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al.
Haplogroup - an overview | ScienceDirect Topics The fragments were run on the ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ : Iran: tricontinental nexus for Y-chromosome driven migration. [20] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. A network analysis of representative hg G-P16 Y-STR haplotypes reveals a diffuse cluster (Supplementary Figure S2). The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. A separate study on the Argyns found that 71% of males belong to G1. Nonetheless, coalescent times provide a valuable/informative relative metric for estimating the time of lineage formation. "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. New York: Columbia University Press, 1987. Men with the haplogroup G marker moved into Europe in Neolithic times. CAS
8 Oldest Haplogroups and the Regions they Originated From Y chromosome sequence variation and the history of human populations. Eur J Hum Genet 2008; 16: 374386. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. AAL thanks the Sorenson Molecular Genealogy Foundation.
Haplogroup G-M201 | Familypedia | Fandom We estimate that the geographic origin of hg G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. Iceman tzi, known to have been a haplogr. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2).
Origins and history of European Y-DNA and mtDNA haplogroups In the case of the general frequency pattern of hg G, panel (a) was obtained by applying the frequencies from Supplementary Table S1 together with data taken from the literature, concerning 569 individuals representing 7 populations comprising Algerians,47 Oromo and Amhara Ethiopians,48 and Berbers, Arabs and Saharawis from Morocco.49 Dots on the map (a) indicate the approximate locations of the sampled populations. Achilli A, Olivieri A, Pala M et al. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. This is achieved by comparing the haplotypes through the STR markers. Chromosome Y microsatellites: population genetic and evolutionary aspects. Y chromosomal heritage of Croatian population and its island isolates. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Because M201 was identified first, it is the standard SNP test used when testing for G persons. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. The G-M286 subclade (M286+) is small compared with G-L91. Haplogroup H dominates present-day Western European mitochondrial DNA variability (>40%), yet was less common (~19%) among Early Neolithic farmers (~5450 BC) and virtually absent in Mesolithic . Gene pool structure of Eastern Ukrainians as inferred from the Y-chromosome haplogroups. Semino et al. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. Yunusbayev B, Metspalu M, Jrve M et al. There are additional subclades of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities. Mol Biol Evol 2011; 29: 359365. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. G2a2b2a is also found in India. G-M377, now also known as G2b1, has previously been designated G2b and G2c. Similarly, G-P16 and G-M377 networks were created using 104 P16-derived 19-locus haplotypes and 61G-M377-derived 9-locus haplotypes, with both groups representing European, Near/Middle Eastern and central/west Asian populations. In the G2a3b-P303 network (Figure 4), there are several region-specific clusters, indicating a considerable history for this SNP.
The genetic variation in the R1a clade among the Ashkenazi - Nature Mol Phylogenet Evol 2007; 44: 228239.